Update of Flu reference
Nobody has claimed this yet.
- Dominant language
- Perl
- Stars
- 29
- Forks
- 3
- PR merge metrics
- No merged PRs in 30d
Description
Hello, i was wondering about the IRMA-flu reference file.
It is 11 years old, and I was evaluating the sequence used and notice a few discrepancies with currently accepted expected lenght in GISAID.
For example for H1, the sequence used in IRMA is 3 nucleotides longer than expected.
`
GSAID 1 ATGAAGGC--- AATACTAGTAGTTATGCTGTATACATTTACAACCGCAAATGCAGACACA 57
IRMA 1 ATGAAGGCAATAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACA 60
`
Also, if I blast against the latest sequence used by Who for vaccine prototyping (A/Missouri/11/2025) the sequence is only 94% similar.
So I wonder if any updates in the reference sequence and the HMM model for alignment.
Thank you.
Contributor guide
No contributing guide indexed for this repository
First steps
- Read the whole issue, then the project's contributing guide.
- Comment on the issue to say you are picking it up — it saves two people doing the same work.
- Fork the repository and make your change on a branch.
- Open a pull request that references the issue number.
Research direction
Start by locating the IRMA-flu reference file and the HMM model used for alignment. Compare the H1 sequence with the GISAID example and the WHO vaccine-prototyping sequence A/Missouri/11/2025, then determine the reference and model updates needed and verify that the revised inputs produce the expected alignment.
Written by the indexing model from the issue text.
Assessment
- Tech stack
- bioinformatics
- Domain
- bioinformatics
- Issue type
- Feature
- Difficulty
- 4/5
- Estimated time
- 3-5 days
- Activity status
- Quiet
- Clarity
- Needs clarification
- Newbie friendliness
- 35/100