bcftools merge changing the alleles
Nobody has claimed this yet.
Assessment
- Difficulty
- 4/5
- Estimated time
- 3-5 days
- Newbie friendliness
- 25/100
- Issue type
- Bug
- Clarity
- Needs clarification
- Activity status
- Stale
- Tech stack
- c
- Domain
- bioinformatics
Research direction
Start by reproducing the reported bcftools merge -m id command with file1.vcf.gz and file2.vcf.gz, comparing the input and output allele strings. Trace the merge path responsible for allele handling and add a regression test using the reported multi-allelic marker; done means merging preserves the complete allele sequences.
Written by the indexing model from the issue text.
Description
Command:
bcftools merge -m id file1.vcf.gz file2.vcf.gz -O z -o output.vcf.gz
For one of the multi-allelic markers, alleles in file1 and file2:
CGAATGGAATGGAATGGAAT CGAATGGAATGGAAT,CAAATGGAATGGAATGGAAT,CGAATGGAATCGAATGGAAT,CGAATGGAATTGAATGGAAT
Alleles in output:
CGAATGGAATG CGAATG,CAAATGGAATG,CGAATGGAATC,CGAATGGAATT
(i.e. it is stripping down the alleles)
File1 and file 2 do not have overlapping samples. Any help with this?
- Dominant language
- C
- Stars
- 891
- Forks
- 277
- Avg merge
- 2d 23h
- Merged PRs (30d)
- 2
Contributor guide
First steps
- Read the whole issue, then the project's contributing guide.
- Comment on the issue to say you are picking it up — it saves two people doing the same work.
- Fork the repository and make your change on a branch.
- Open a pull request that references the issue number.
More from samtools/bcftools
-
needs-feedback
Difficulty 3/5 1-2 days Newbie friendliness 55/100
-
enhancement
Difficulty 5/5 Over a week Newbie friendliness 45/100
-
htslib-dependent P2: Desirable
Difficulty 3/5 1-2 days Newbie friendliness 48/100
-
Difficulty 5/5 Over a week Newbie friendliness 30/100
-
needs-feedback requires-test-case
Difficulty 3/5 1-2 days Newbie friendliness 55/100
All issues in samtools/bcftools
Similar issues
-
[adam] AdamNet network read doesn't cap to MAX_ADAM_PACKET_LEN, overflows client receive buffers Open
Difficulty 2/5 1-3 hours Newbie friendliness 88/100
FujiNetWIFI/fujinet-firmware#1649 · 2 comments ·
-
Difficulty 2/5 1-3 hours Newbie friendliness 68/100
HarbourMasters/Shipwright#7229 ·
-
Difficulty 2/5 1-3 hours Newbie friendliness 72/100
riscv-software-src/riscv-isa-sim#2435 · 1 comment ·
-
bug Self Built Image SNAPSHOT Supported Device target/ramips
Difficulty 2/5 1-3 hours Newbie friendliness 88/100
-
Difficulty 2/5 1-3 hours Newbie friendliness 76/100