An error occurred when running the plotter.R script

Description of the bug

Dear team,
When I run the plotter.R script, it shows: "The 'HOME' environment variable must be set before running Pandoc." What could be the possible reasons?
Thanks,
sunfei

Error executing process > 'NFCORE_CRISPRSEQ:CRISPRSEQ_TARGETED:CRISPRSEQ_PLOTTER (Cas9-KO)'

Caused by:
Process NFCORE_CRISPRSEQ:CRISPRSEQ_TARGETED:CRISPRSEQ_PLOTTER (Cas9-KO) terminated with an error exit status (1)

Command executed:

plotter.R
--cut_site=-3
--indels_info=Cas9-KO_indels.csv
--reference=targert-correctOrient.fasta
--gRNA_sequence=CACCAGCAGTCCTATCTGCT
--sample_name=Cas9-KO
--substitutions_info=Cas9-KO_subs-perc.csv

cat <<-END_VERSIONS > versions.yml
"NFCORE_CRISPRSEQ:CRISPRSEQ_TARGETED:CRISPRSEQ_PLOTTER":
ggplot2: $(Rscript -e "cat(paste(packageVersion('ggplot2'), collapse='.'))")
ShortRead: $(Rscript -e "cat(paste(packageVersion('ShortRead'), collapse='.'))")
plyr: $(Rscript -e "cat(paste(packageVersion('plyr'), collapse='.'))")
dplyr: $(Rscript -e "cat(paste(packageVersion('dplyr'), collapse='.'))")
seqinr: $(Rscript -e "cat(paste(packageVersion('seqinr'), collapse='.'))")
ggpubr: $(Rscript -e "cat(paste(packageVersion('ggpubr'), collapse='.'))")
ggmsa: $(Rscript -e "cat(paste(packageVersion('ggmsa'), collapse='.'))")
seqmagick: $(Rscript -e "cat(paste(packageVersion('seqmagick'), collapse='.'))")
stringr: $(Rscript -e "cat(paste(packageVersion('stringr'), collapse='.'))")
tidyr: $(Rscript -e "cat(paste(packageVersion('tidyr'), collapse='.'))")
ggseqlogo: $(Rscript -e "cat(paste(packageVersion('ggseqlogo'), collapse='.'))")
plotly: $(Rscript -e "cat(paste(packageVersion('plotly'), collapse='.'))")
cowplot: $(Rscript -e "cat(paste(packageVersion('cowplot'), collapse='.'))")
END_VERSIONS

Command exit status:
1

Command output:
(empty)

Command error:
layout

Attaching package: ‘cowplot’

The following object is masked from ‘package:ggpubr’:

  get_legend

Error in with_pandoc_safe_environment(system(paste(shQuote(path), "--version"), :
The 'HOME' environment variable must be set before running Pandoc.
Calls: ... FUN -> get_pandoc_version -> with_pandoc_safe_environment
In addition: Warning messages:
1: The `` argument of guides() cannot be `FALSE`. Use "none" instead as
of ggplot2 3.3.4.
ℹ The deprecated feature was likely used in the ggseqlogo package.
Please report the issue at .
2: In RColorBrewer::brewer.pal(N, "Set2") :
n too large, allowed maximum for palette Set2 is 8
Returning the palette you asked for with that many colors

3: In RColorBrewer::brewer.pal(N, "Set2") :
n too large, allowed maximum for palette Set2 is 8
Returning the palette you asked for with that many colors

4: In RColorBrewer::brewer.pal(N, "Set2") :
n too large, allowed maximum for palette Set2 is 8
Returning the palette you asked for with that many colors

5: In RColorBrewer::brewer.pal(N, "Set2") :
n too large, allowed maximum for palette Set2 is 8
Returning the palette you asked for with that many colors

6: In RColorBrewer::brewer.pal(N, "Set2") :
n too large, allowed maximum for palette Set2 is 8
Returning the palette you asked for with that many colors

Execution halted

Work dir:
/mnt/sdb/sunfei/scflRNA/nf_core/crisprseq-master/work/b6/17953ec27c1bee0bf23f60027adebb

Container:
/mnt/sdb/sunfei/charliecloud_cache/img/quay.io%biocontainers%mulled-v2-6de07928379e6eface08a0019c4a1d6b5192e805+0d77388f37ddd923a087f7792e30e83ab54c918c-0

Tip: view the complete command output by changing to the process work dir and entering the command cat .command.out

Command used and terminal output

Relevant files

No response

System information

No response

Start with the NFCORE_CRISPRSEQ:CRISPRSEQ_TARGETED:CRISPRSEQ_PLOTTER process and the plotter.R command shown in the report. Inspect the work directory's .command.out and the reported Pandoc failure, including the runtime environment. Done means the process completes successfully without the HOME-related error.