How to map TAB/CSV attributes to InterMine model?

Sample file:

```
#AlleleID Type Name GeneID GeneSymbol HGNC_ID ClinicalSignificance ClinSigSimple LastEvaluated RS# (dbSNP) nsv/esv (dbVar) RCVaccession PhenotypeIDS PhenotypeList Origin OriginSimple Assembly ChromosomeAccession Chromosome Start Stop ReferenceAllele AlternateAllele Cytogenetic ReviewStatus NumberSubmitters Guidelines TestedInGTR OtherIDs SubmitterCategories VariationID
15041 indel NM_014855.2(AP5Z1):c.80_83delGGATinsTGCTGTAAACTGTAACTGTAAA (p.Arg27_Ala362delinsLeuLeuTer) 9907 AP5Z1 HGNC:22197 Pathogenic 1 Jun 29, 2010 397704705 - RCV000000012 MedGen:C3150901,OMIM:613647 Spastic paraplegia 48, autosomal recessive germline germline GRCh37 NC_000007.13 7 4820844 4820847 GGAT TGCTGTAAACTGTAACTGTAAA 7p22.1 no assertion criteria provided 1 N OMIM Allelic Variant:613653.0001 1 2
15041 indel NM_014855.2(AP5Z1):c.80_83delGGATinsTGCTGTAAACTGTAACTGTAAA (p.Arg27_Ala362delinsLeuLeuTer) 9907 AP5Z1 HGNC:22197 Pathogenic 1 Jun 29, 2010 397704705 - RCV000000012 MedGen:C3150901,OMIM:613647 Spastic paraplegia 48, autosomal recessive germline germline GRCh38 NC_000007.14 7 4781213 4781216 GGAT TGCTGTAAACTGTAACTGTAAA 7p22.1 no assertion criteria provided 1 N OMIM Allelic Variant:613653.0001 1 2

```

We will really need Yo's research for this! :)

To map, we need a name for each column:

1. require a header.
2. if no header, they have to label each column

How do we know which fields go with which columns? Maybe user can grab a slider? "Gene" + "experimental results"?

Another option is to have a few standard model snippets for standard experiment types. And map to that.

Will need some thinking!