fastq groomer does not parse sequence ids that contain spaces properly

The issue is that the FastqReader class parses the entire "@" line as a sequence id. The specification actually allows for an "optional" description, similar to FASTA which comes after a space. Some files I have seen (such as those from the iMicrobe Project) contain lines like:

```
@
ATCGGTTTCGTTGTGTTATTCGCGGCCAAGGGTTTTGTCGTCGTTATATT
+
^__ec\cccgce]`J[R`[[`ee][ccecag__aafU\baT_WLY^\Xac
```

These result in the following error:

```
Exception: Invalid FASTQ file: could not find quality score of sequence identifier @ .
```

I believe this would be a simple fix, however, I'm not actually sure where the code for those utility classes is hosted.