Force insertions to align with codon boundaries

In the 09-Dec-2016.M01841 run, sample PNL4-3-1-V3LOOP_S73 reported a strange consensus sequence.

After digging into the problem, we found that a six-base insertion wasn't aligned with the codon boundaries. Here's a portion of the HIV1B-env reference we use, with the usual insertion marked with dashes:

AGTATACATATA------GGACCAGGG

The amino acid equivalent is:

SIHIGPG

Here's a portion of one of the sample's reads, as bowtie2 aligned it with the reference below:

AGTATCCGTATCCAGAGGGGACCAGGG
AGTATACATAT------AGGACCAGGG

You can see that the insertion is base to the left of its usual position. That pulls the G from the right side of the insertion over to the left, and is translated as the following amino acid sequence:

SIRMGPG

One possible solution: if an insertion's length is a multiple of three, then force it to align with the codon boundaries. For now, just choose the closest codon boundary.

The issue names no files or tests; start by locating the consensus and alignment handling for insertions in the MiCall pipeline and reproduce the 09-Dec-2016.M01841 case. Done means a six-base insertion is placed at the closest codon boundary and produces the intended translated sequence.